Genética Forense

Genética Forense

Identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe, do filho e do suposto pai.

O exame de DNA para fins de identificação pessoal e determinação de paternidade maior avanço do século na área forense

Determinar paternidade com absoluta confiabilidade

Disputas legais para pensão alimentícia e herança

Casos criminais : estupro, rapto, troca ou abandono de crianças minissatélites (VNTRs -Variable Number of

Tandem Repeats) e microssatélites (STR - Short Tandem Repeat)

Sequências curtas e hipervariáveis regiões polimórficas mais de um alelo por locus polimórficas mais de um alelo por locus sequências repetitivas de 1 a 4 pb com distribuição ao longo do genoma.

Herança Mendeliana (os filhos sempre recebem metade dos alelos de origem materna e metade de origem paterna).

Repetição de 1 base: GTAAAAAAAAAAAAAAAGGAT

Repetição de 2 bases: GTCACACACACACACACAGGAT (dinucleotídeo) GTCACACACACACACACAGGAT (dinucleotídeo)

Repetição de 3 bases: GTCACCACCACCACCACCACGGAT (trinucleotídeo)

Repetição de 4 bases: GTCAGACAGACAGACAGAGGAT (tetran ucleotídeo)

Com 12-20 VNTR’s, é possível obter perfis genéticos praticamente indivíduo-específicos (DNA Fingerprinting)

* TÉCNICAS • RFLP (Restriction Fragment Lenght Polymorphism).

• PCR (Polymerase Chain Reaction).

Sangue padrão- ouro; células epiteliais da mucosa oral: saliva, pontas de cigarro, selos e envelopes, gomas de mascar, copos, tampas de caneta mordidas;de mascar, copos, tampas de caneta mordidas;

Pêlos e fios de cabelo;

Unhas; Esfregaços;

Manchas de material biológico: líquido seminal, urina, saliva, sangue;

Tecidos de biópsias cirúrgicas;

Ossadas (carbonizadas ou não);

Tecidos mumificados ou congelados;

Células deixadas por impressão digital;

Dentes; outras

Princípio do método: após clivagem por endonucleases, cada indivíduo tem um padrão de bandas específico com tamanhos determinados pela bandas específico com tamanhos determinados pela presença, ou não, do sítio da enzima e pela quantidade de repetições em tandem. Para que se possa visualizar, esses fragmentos devem ser hibridizados a sondas radioativas de seqüência invariável.

Figura 3 -Inclusão de paternidade (RFLP) com sondas MS1, MS31,

MS43 e MS621. Na coluna 1, 2 e 3 observam-se as bandas de DNA da mãe, do filho e do suposto pai, respectivamente. Facilmente detectamos as bandas maternas(M), presentes no filho, sendo que as bandas paternas (P) estão também presentes no investigado. Os marcadores de peso molecular encontram-se nas laterais

Exclusão de paternidade (RFLP) com sondas MS31, MS43, MS205 e G3 (RFLP). Na coluna 1, 2, e 3, observam-se as bandas de DNA da mãe, do filho e do suposto pai, respectivamente. Facilmente detectamos as bandas maternas (M), presentes no filho, sendo que as demais são obrigatoriamente de origem paterna. O investigado não apresenta essas últimas. A coluna 4 representa a mistura do DNA do filho e do suposto pai. O marcador de peso molecular encontra-se na lateral esquerda.

Investigação de troca em maternidade. Na coluna 1, pode-se observar o DNA de uma das crianças analisado com as sondas unilocais ( RFLP ) MS205, MS1, MS31 e G3. Na coluna 2, o DNA de uma das mães, casada com o possível pai com DNA presente na coluna 4. Na coluna 3, encontramos o DNA da mãe verdadeira, que não estava de posse da criança, podendo-se facilmente observar que uma das suas bandas está sempre presente na criança (coluna 1). O possível pai (coluna 4) e sua esposa (coluna 2) foram excluídos da paternidade e da maternidade por não apresentarem alelos ou bandas de DNA em comum com a criança (coluna 1). A probabilidade de maternidade para a mãe da coluna 3 foi de 9,9%. A outra criança estava desaparecida.

Vantagem sobre os VNTR: a amostra a ser analisada pode ter uma quantidade inicial de DNA muito menor.

Mesmo existindo contaminação por DNA de Mesmo existindo contaminação por DNA de outras espécies, a técnica de PCR é específica o suficiente para amplificar apenas o DNA hu mano

Em casos de estupro, é possível também o congelamento do DNA vaginal, extraído após a violação, permitindo realizar o estudo comparativo com o DNA

Algumas pessoas solicitam o estudo de suas características imunogenéticas, procurando deixar documentada, em forma de laudo médico, sua individualidade molecular. Os estudos podem ser os de perfil do DNA de STR.

Car act er ísticas impor tant es :

Também contém regiões polimórficas que permitem a “individualização”;

Homens recebem apenas do pai permite Homens recebem apenas do pai permite traçar a linhagem paterna de um homem;

Identificação de paternidade sem o pai (p/ filhos);

Elucidação de estupro (mistura de DNA);

Não identifica um indivíduo específico; Não identifica um indivíduo específico; Estudos históricos ou evolutivos;

Comentários